Determination Of Antimicrobial Resistance Of Escherichia Coli Isolated From Rastrineobola Argentea And Water Samples From Lake Victoria - Kenya
Subscribe to read and download this work.
ABSTRACT
Many strains of Escherichia coli can be pathogenic leading to diarrheal diseases. The occurrence of antimicrobial resistant bacteria is increasing in aquatic environments infecting fish which are later consumed by humans when not well cooked posing a major problem in the management of bacterial infections. Rastrineobola argentea is food for many people livingaround Lake Victoria due to its nutritive value and highprotein content. Sun dried R. argentea retailed in Kisumu city markets have been shown to be contaminated with antimicrobial resistant E. coli which could be as a result of how they are processed including drying them on the sand and dirty mats. Studies done so far with Salmonella species have indicated a difference in Salmonella species contamination in different types of beaches and different bacteria concentrations at different distances from the shoreline into the lake interior. Vt1 gene has been shown to be a determinant factor for virulence. This was why this study was undertaken to determine the antimicrobial resistance of E. coli isolated from freshly fished R. argentea and in lake water in Dunga and Uyoma Naya beaches in Lake Victoria Kenya. A cross sectional study design was used to collect 36 R. argentea and 36 water samples from Dunga beach and 36 R. argentea and 36 water samples from Uyoma Naya beach in sterilized plastic bags and bottles. Standard microbiological procedures were used to isolate and determine E. coli phenotypes from the samples within which 16 R. argentea and 9 water samples from Dunga and 8 R. argentea and 8 water samples from Uyoma Naya were found to be contaminated with verotoxin - producing E. coli (VTEC).The isolates were later screened for antibiotic resistance using the disk – diffusion technique. All 41 isolates were resistant to Ampicillin/Cloxallin, 65.9% were resistant to Tetracycline, 4.9% were resistant to Cefuroxime, and 2.4% were resistant to Nalidixic Acid. There was no resistance to Chloramphenicol, Gentamicin and Co-Trimoxazole. Monoplex PCR was performed on eight of the E. coli isolates that were both resistant to Ampicillin/Cloxallin and Tetracycline using a verotoxin gene (vt1) as the primer of 5’CGCTGAATGTCATTCGCTCTGC3’ nucleotide base sequence and a 772 – 812 product size in base pairs. Dunga and Uyoma Naya beaches have antimicrobial resistant E. coli. There was a significant difference in E. coli contamination levels between the two beaches shown by Ts = 36.9928 (P< 0.05). The results give an insight for continuous research on antibiotic susceptibility surveillance in the aquatic environments where R. argentea and water are obtained for human consumption since the rate of antibiotic resistance keep on changing from time to time due to the fact that E. coli is a hardy environmental isolate and is indicative of fecal contamination in food stuff or water for it is only found as a resident microbe in the intestine.
Reviews
No reviews yet.
APA
(2026). Determination Of Antimicrobial Resistance Of Escherichia Coli Isolated From Rastrineobola Argentea And Water Samples From Lake Victoria - Kenya. Afribary. Retrieved June 14, 2026, from http://library.afribary.com/works/determination-of-antimicrobial-resistance-of-escherichia-coli-isolated-from-rastrineobola-argentea-and-water-samples-from-lake-victoria-kenya
MLA
"Determination Of Antimicrobial Resistance Of Escherichia Coli Isolated From Rastrineobola Argentea And Water Samples From Lake Victoria - Kenya." Afribary, 6 Jun. 2026, http://library.afribary.com/works/determination-of-antimicrobial-resistance-of-escherichia-coli-isolated-from-rastrineobola-argentea-and-water-samples-from-lake-victoria-kenya. Accessed June 14, 2026.
Chicago
"Determination Of Antimicrobial Resistance Of Escherichia Coli Isolated From Rastrineobola Argentea And Water Samples From Lake Victoria - Kenya." Afribary (2026). Accessed June 14, 2026. http://library.afribary.com/works/determination-of-antimicrobial-resistance-of-escherichia-coli-isolated-from-rastrineobola-argentea-and-water-samples-from-lake-victoria-kenya